ID: 988839360_988839364

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 988839360 988839364
Species Human (GRCh38) Human (GRCh38)
Location 5:35068086-35068108 5:35068104-35068126
Sequence CCAGGAGAGACAGTCCAAAAAGG AAAGGCTGGCTGAAACTACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 186} {0: 1, 1: 1, 2: 0, 3: 9, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!