ID: 988895636_988895640

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 988895636 988895640
Species Human (GRCh38) Human (GRCh38)
Location 5:35670785-35670807 5:35670806-35670828
Sequence CCAACTACTAACTGTGTGACCTT TTAGGTGACCAGTTCATTAAGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 58, 3: 436, 4: 2017} {0: 1, 1: 0, 2: 1, 3: 3, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!