ID: 988918478_988918489

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 988918478 988918489
Species Human (GRCh38) Human (GRCh38)
Location 5:35919806-35919828 5:35919858-35919880
Sequence CCATTGACTGTAGACTGGTTCCC CAGTGGGTATGGGGTGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 107} {0: 1, 1: 0, 2: 2, 3: 38, 4: 419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!