ID: 988930866_988930874

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 988930866 988930874
Species Human (GRCh38) Human (GRCh38)
Location 5:36034548-36034570 5:36034584-36034606
Sequence CCTGTCCTTGGAAACACAGCTAC CTTCTCATCCACATGGAGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 16, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!