|
Left Crispr |
Right Crispr |
| Crispr ID |
988932167 |
988932169 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:36047290-36047312
|
5:36047304-36047326
|
| Sequence |
CCTCCTGAAGCTGTCATGGGTGC |
CATGGGTGCATCCTCAACCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 10, 3: 23, 4: 143} |
{0: 9, 1: 49, 2: 106, 3: 235, 4: 492} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|