ID: 988949366_988949379

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 988949366 988949379
Species Human (GRCh38) Human (GRCh38)
Location 5:36241749-36241771 5:36241800-36241822
Sequence CCCGCCACGCGACAACAGCTGCC GTGGGCCGGGCCGCGGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 97} {0: 1, 1: 0, 2: 4, 3: 55, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!