ID: 988954784_988954789

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 988954784 988954789
Species Human (GRCh38) Human (GRCh38)
Location 5:36304421-36304443 5:36304471-36304493
Sequence CCAGCATGGCAGAAAGCAGCACG ATATATCAGCTACAGTGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 227} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!