ID: 988990024_988990031

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 988990024 988990031
Species Human (GRCh38) Human (GRCh38)
Location 5:36661639-36661661 5:36661678-36661700
Sequence CCCAGCCTCATGACTGGGCCTGG CAGCTGTTCTTTGGCAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 309} {0: 1, 1: 0, 2: 1, 3: 33, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!