ID: 988995064_988995069

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 988995064 988995069
Species Human (GRCh38) Human (GRCh38)
Location 5:36706826-36706848 5:36706860-36706882
Sequence CCAACCTTGGCTGCACATTGGAA TCTTTCAAAACACTGAATCCTGG
Strand - +
Off-target summary {0: 5, 1: 5, 2: 52, 3: 143, 4: 421} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!