ID: 988999844_988999850

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 988999844 988999850
Species Human (GRCh38) Human (GRCh38)
Location 5:36748780-36748802 5:36748814-36748836
Sequence CCTTCTACGCTCACTGATGGCCC GACCCTCTGCTTGTCTCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99} {0: 1, 1: 0, 2: 1, 3: 19, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!