ID: 989038429_989038432

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 989038429 989038432
Species Human (GRCh38) Human (GRCh38)
Location 5:37199889-37199911 5:37199911-37199933
Sequence CCCAAGCCAGTCTCACTAAGAGT TGAATCTCAATCCTCTTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 188} {0: 1, 1: 0, 2: 1, 3: 9, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!