ID: 989038429_989038434

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 989038429 989038434
Species Human (GRCh38) Human (GRCh38)
Location 5:37199889-37199911 5:37199920-37199942
Sequence CCCAAGCCAGTCTCACTAAGAGT ATCCTCTTGCTTGGAATGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 188} {0: 1, 1: 0, 2: 0, 3: 22, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!