ID: 989038430_989038432

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 989038430 989038432
Species Human (GRCh38) Human (GRCh38)
Location 5:37199890-37199912 5:37199911-37199933
Sequence CCAAGCCAGTCTCACTAAGAGTG TGAATCTCAATCCTCTTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 95} {0: 1, 1: 0, 2: 1, 3: 9, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!