ID: 989043121_989043131

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 989043121 989043131
Species Human (GRCh38) Human (GRCh38)
Location 5:37249318-37249340 5:37249359-37249381
Sequence CCAGGCCGACAGCTGCGGGCCCT AGCCTGCGTCCTGGCGACGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 134} {0: 1, 1: 0, 2: 1, 3: 6, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!