ID: 989043122_989043130

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 989043122 989043130
Species Human (GRCh38) Human (GRCh38)
Location 5:37249323-37249345 5:37249356-37249378
Sequence CCGACAGCTGCGGGCCCTACCGC GCGAGCCTGCGTCCTGGCGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86} {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!