ID: 989043123_989043133

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 989043123 989043133
Species Human (GRCh38) Human (GRCh38)
Location 5:37249337-37249359 5:37249362-37249384
Sequence CCCTACCGCCAGCCCTGACGCGA CTGCGTCCTGGCGACGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 38} {0: 1, 1: 0, 2: 1, 3: 7, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!