ID: 989043125_989043138

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 989043125 989043138
Species Human (GRCh38) Human (GRCh38)
Location 5:37249342-37249364 5:37249371-37249393
Sequence CCGCCAGCCCTGACGCGAGCCTG GGCGACGGCGGAGGGCGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 181} {0: 1, 1: 2, 2: 6, 3: 86, 4: 697}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!