ID: 989069047_989069054

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 989069047 989069054
Species Human (GRCh38) Human (GRCh38)
Location 5:37490952-37490974 5:37490993-37491015
Sequence CCAGAAAGAAAACAGACTGGTGG CGTGCCATGCTGCAGGTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 245} {0: 1, 1: 0, 2: 1, 3: 22, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!