ID: 989082275_989082286

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 989082275 989082286
Species Human (GRCh38) Human (GRCh38)
Location 5:37635776-37635798 5:37635814-37635836
Sequence CCCAAATCTCATCTTGAATTGTA ATGTGTCATGGGAGGGTGGGAGG
Strand - +
Off-target summary {0: 6802, 1: 10434, 2: 9513, 3: 7783, 4: 4679} {0: 1, 1: 0, 2: 1, 3: 36, 4: 500}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!