|
Left Crispr |
Right Crispr |
| Crispr ID |
989082276 |
989082286 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:37635777-37635799
|
5:37635814-37635836
|
| Sequence |
CCAAATCTCATCTTGAATTGTAG |
ATGTGTCATGGGAGGGTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4048, 1: 7216, 2: 8939, 3: 8984, 4: 9244} |
{0: 1, 1: 0, 2: 1, 3: 36, 4: 500} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|