ID: 989104585_989104591

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 989104585 989104591
Species Human (GRCh38) Human (GRCh38)
Location 5:37849593-37849615 5:37849612-37849634
Sequence CCTGGGAGCCTGGTAATTACCAC CCACAGAGCGAGGCGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85} {0: 1, 1: 0, 2: 1, 3: 26, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!