ID: 989146482_989146492

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 989146482 989146492
Species Human (GRCh38) Human (GRCh38)
Location 5:38256039-38256061 5:38256079-38256101
Sequence CCAAATCGCCTATGGTCATCTGC GCCCAGGGCCAGGGATGCCGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 50, 4: 466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!