ID: 989161211_989161222

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 989161211 989161222
Species Human (GRCh38) Human (GRCh38)
Location 5:38393606-38393628 5:38393659-38393681
Sequence CCTTCGTGGGCTGGAACTGGAGT GTCCTTGCGGGAGGAAGAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!