ID: 989162692_989162707

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 989162692 989162707
Species Human (GRCh38) Human (GRCh38)
Location 5:38406929-38406951 5:38406973-38406995
Sequence CCCTACCTCAGCATCTCTCCCTG CCATTCCCATACAGAGAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 511} {0: 1, 1: 0, 2: 3, 3: 27, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!