ID: 989162697_989162707

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 989162697 989162707
Species Human (GRCh38) Human (GRCh38)
Location 5:38406947-38406969 5:38406973-38406995
Sequence CCCTGTGACCACGGTGGCTCCCC CCATTCCCATACAGAGAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 126} {0: 1, 1: 0, 2: 3, 3: 27, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!