|
Left Crispr |
Right Crispr |
| Crispr ID |
989180074 |
989180076 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:38567786-38567808
|
5:38567802-38567824
|
| Sequence |
CCCAAAGTGCTGGGATTATAGGC |
TATAGGCATGAGCCACCACCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 20277, 1: 245443, 2: 271371, 3: 174555, 4: 143969} |
{0: 5, 1: 54, 2: 172, 3: 469, 4: 839} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|