ID: 989196753_989196755

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 989196753 989196755
Species Human (GRCh38) Human (GRCh38)
Location 5:38723900-38723922 5:38723932-38723954
Sequence CCATAGACGGGGTAGCTTATAAA TTTATTTTTCACAGTTCTGGAGG
Strand - +
Off-target summary No data {0: 115, 1: 1420, 2: 3347, 3: 5203, 4: 7343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!