ID: 989201628_989201639

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 989201628 989201639
Species Human (GRCh38) Human (GRCh38)
Location 5:38769984-38770006 5:38770025-38770047
Sequence CCCCCACCCAGCTAAAACACAGA GTGTCTCTGAGCTCACAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 321} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!