ID: 989247490_989247494

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 989247490 989247494
Species Human (GRCh38) Human (GRCh38)
Location 5:39270221-39270243 5:39270246-39270268
Sequence CCTGGGATCCAAACTGCTCATAA GGAAACTCGACTAAATTACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 108} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!