ID: 989378552_989378560

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 989378552 989378560
Species Human (GRCh38) Human (GRCh38)
Location 5:40791052-40791074 5:40791069-40791091
Sequence CCCCACCATCACTGTGCAGTGAG AGTGAGAGGGACAAAGGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 218} {0: 1, 1: 0, 2: 1, 3: 44, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!