|
Left Crispr |
Right Crispr |
| Crispr ID |
989468209 |
989468212 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:41782625-41782647
|
5:41782672-41782694
|
| Sequence |
CCTTCCAGACTCTGGATATTAGT |
AATATTTTCTCACATTCTGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 93, 3: 1381, 4: 4893} |
{0: 44, 1: 2850, 2: 14540, 3: 18082, 4: 10017} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|