ID: 989486381_989486387

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 989486381 989486387
Species Human (GRCh38) Human (GRCh38)
Location 5:41996343-41996365 5:41996388-41996410
Sequence CCAAAGCCCAGTAACAGGCCAAG AGTTATCTGCAAAAGATGGCAGG
Strand - +
Off-target summary {0: 169, 1: 171, 2: 103, 3: 76, 4: 232} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!