ID: 989537792_989537795

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 989537792 989537795
Species Human (GRCh38) Human (GRCh38)
Location 5:42583444-42583466 5:42583471-42583493
Sequence CCTGCTGCCCTCTAGTGGAAGTG CAAGCAGCAAAATATTTAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 41, 4: 531}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!