|
Left Crispr |
Right Crispr |
| Crispr ID |
989545338 |
989545349 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:42665964-42665986
|
5:42665999-42666021
|
| Sequence |
CCCCCATGATTCAATTACCTTCC |
TCATGACACATGCGGATTATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 184, 1: 3372, 2: 6558, 3: 9434, 4: 9921} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|