|
Left Crispr |
Right Crispr |
| Crispr ID |
989545339 |
989545348 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:42665965-42665987
|
5:42665998-42666020
|
| Sequence |
CCCCATGATTCAATTACCTTCCA |
CTCATGACACATGCGGATTATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 178, 1: 3381, 2: 6698, 3: 9592, 4: 11032} |
{0: 2, 1: 47, 2: 581, 3: 1510, 4: 2895} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|