|
Left Crispr |
Right Crispr |
Crispr ID |
989545339 |
989545350 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:42665965-42665987
|
5:42666002-42666024
|
Sequence |
CCCCATGATTCAATTACCTTCCA |
TGACACATGCGGATTATGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 178, 1: 3381, 2: 6698, 3: 9592, 4: 11032} |
{0: 1, 1: 2, 2: 1, 3: 17, 4: 84} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|