ID: 989545343_989545350

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 989545343 989545350
Species Human (GRCh38) Human (GRCh38)
Location 5:42665985-42666007 5:42666002-42666024
Sequence CCACCAGCTCCCTCTCATGACAC TGACACATGCGGATTATGGGAGG
Strand - +
Off-target summary {0: 1, 1: 36, 2: 430, 3: 1400, 4: 3824} {0: 1, 1: 2, 2: 1, 3: 17, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!