|
Left Crispr |
Right Crispr |
| Crispr ID |
989545344 |
989545351 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:42665988-42666010
|
5:42666028-42666050
|
| Sequence |
CCAGCTCCCTCTCATGACACATG |
AATTCAAGATGTGATTTGTATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 33, 2: 420, 3: 1135, 4: 2914} |
{0: 1, 1: 16, 2: 917, 3: 10071, 4: 14054} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|