ID: 989545346_989545352

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 989545346 989545352
Species Human (GRCh38) Human (GRCh38)
Location 5:42665994-42666016 5:42666029-42666051
Sequence CCCTCTCATGACACATGCGGATT ATTCAAGATGTGATTTGTATGGG
Strand - +
Off-target summary {0: 2, 1: 51, 2: 645, 3: 1637, 4: 3514} {0: 1, 1: 16, 2: 863, 3: 9855, 4: 12207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!