|
Left Crispr |
Right Crispr |
Crispr ID |
989545346 |
989545352 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:42665994-42666016
|
5:42666029-42666051
|
Sequence |
CCCTCTCATGACACATGCGGATT |
ATTCAAGATGTGATTTGTATGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 51, 2: 645, 3: 1637, 4: 3514} |
{0: 1, 1: 16, 2: 863, 3: 9855, 4: 12207} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|