ID: 989550000_989550009

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 989550000 989550009
Species Human (GRCh38) Human (GRCh38)
Location 5:42723479-42723501 5:42723512-42723534
Sequence CCTACATCCCTCTGAGTAGACTG TGGTGAATCTGGGGAATGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 35, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!