ID: 989552554_989552563

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 989552554 989552563
Species Human (GRCh38) Human (GRCh38)
Location 5:42752739-42752761 5:42752785-42752807
Sequence CCCAAAGTGCTGGGATTACAGGC CACAGCTAACATTTTGATGGAGG
Strand - +
Off-target summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!