ID: 989565171_989565176

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 989565171 989565176
Species Human (GRCh38) Human (GRCh38)
Location 5:42894459-42894481 5:42894477-42894499
Sequence CCCGAGGCACCCCAGTGGGGACC GGACCCTCTTGCCGTCCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 20, 4: 209} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!