ID: 989568949_989568964

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 989568949 989568964
Species Human (GRCh38) Human (GRCh38)
Location 5:42927242-42927264 5:42927293-42927315
Sequence CCCAAAGTGCTTGGATTGCAGAC GGGGCGGGAACTGCTTTTTCAGG
Strand - +
Off-target summary {0: 4, 1: 306, 2: 15896, 3: 261797, 4: 286959} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!