ID: 989575619_989575628

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 989575619 989575628
Species Human (GRCh38) Human (GRCh38)
Location 5:42985457-42985479 5:42985494-42985516
Sequence CCTTCAAATTCATCATTCCAGAG GTTTTTAAGGGGATTGTGGAGGG
Strand - +
Off-target summary No data {0: 6, 1: 27, 2: 45, 3: 72, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!