ID: 989586195_989586198

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 989586195 989586198
Species Human (GRCh38) Human (GRCh38)
Location 5:43075447-43075469 5:43075480-43075502
Sequence CCCAGTCTAACATGACTGCTATG CGGCCTCTTTCTCGATCTTCAGG
Strand - +
Off-target summary No data {0: 2, 1: 23, 2: 29, 3: 38, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!