ID: 989595178_989595180

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 989595178 989595180
Species Human (GRCh38) Human (GRCh38)
Location 5:43150038-43150060 5:43150064-43150086
Sequence CCATGTTTGTATCAGTGTTTCTT CCCTGTCCCCCTAGTCCCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 36, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!