ID: 989635614_989635616

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 989635614 989635616
Species Human (GRCh38) Human (GRCh38)
Location 5:43529797-43529819 5:43529810-43529832
Sequence CCCGGATAAATCTGTTCCATTTT GTTCCATTTTCTTCATAATCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 25, 4: 369} {0: 2, 1: 0, 2: 1, 3: 20, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!