ID: 989685937_989685940

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 989685937 989685940
Species Human (GRCh38) Human (GRCh38)
Location 5:44087372-44087394 5:44087399-44087421
Sequence CCATATTGTAAAGGAATTCAGTC TTAGAACCATGGAATTTTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 26, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!