ID: 989697871_989697879

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 989697871 989697879
Species Human (GRCh38) Human (GRCh38)
Location 5:44224896-44224918 5:44224940-44224962
Sequence CCATGGCATCCTTGGGGCTGCCT TGTGCGCAATGGGAGATAGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!