|
Left Crispr |
Right Crispr |
| Crispr ID |
989785009 |
989785012 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:45316560-45316582
|
5:45316591-45316613
|
| Sequence |
CCAGGGCAATCAGGCAGGAGAAA |
GGGTATTCAATTACAAAAAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1404, 1: 6333, 2: 8242, 3: 5226, 4: 4230} |
{0: 4, 1: 87, 2: 7304, 3: 4142, 4: 2655} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|